PE-Analyzer

Prime editing outcomes from NGS reads, run entirely in your browser

What a prime editing experiment actually produced, read from the sequencing files. Reads are joined, aligned against both the reference and the intended sequence, and counted — a read that is an insertion against the reference and a match against the intended sequence is the edit working, while the same insertion against both is not.

Sequencing reads

ID 1

Showing the example below — fill in the target and this becomes yours.

Top: reference · bottom: intended sequence

AAACGCCCATGCAATTAGTCTATTTCTGCTGCAAGTAAGCATGCATTTGTAGGCTTGATGCTTTTTTTCTGCTTCTCCAGCCCTGGCCTGGGTCAATCCTTGGGGCCCAGACTGAGCACG
AAACGCCCATGCAATTAGTCTATTTCTGCTGCAAGTAAGCATGCATTTGTAGGCTTGATGCTTTTTTTCTGCTTCTCCAGCCCTGGCCTGGGTCAATCCTTGGGGCCCAGACTGAGCACG
---TGATGGCAGAGGAAAGGAAGCCCTGCTTCCTCCAGAGGGCGTCGCAGGACAGCTTTTCCTAGACAGGGGCTAGTATGTGCAGCTCCTGCACCGGGATACTGGTTGACAAGTTTGGCT
CTTTGATGGCAGAGGAAAGGAAGCCCTGCTTCCTCCAGAGGGCGTCGCAGGACAGCTTTTCCTAGACAGGGGCTAGTATGTGCAGCTCCTGCACCGGGATACTGGTTGACAAGTTTGGCT
GG
GG

Guide on the forward strand, cleaving after position 120. Intended edit: insertion of CTT (3 nt) at position 121. Comparison range 50–190 of 239 nt.

ATGC Indicator sequence ATGC pegRNA target ATGC Induced sequence ATGC Additional nicking target ATGC Prime-edit marker

Target

Recorded, not used: the nick is located from where the spacer sits in the reference — 17 nt in on the forward strand, 3 nt on the reverse — so no PAM enters the arithmetic.

Without the PAM. It has to appear in the reference on one strand or the other.

Counted from the nick: position 1 is the base immediately 3′ of it.

Nothing written yet — Apply fills the intended sequence the analysis reads.

Reads are compared over R bp either side of the nick.

Sequences seen n times or fewer are discarded.

Applied symmetrically to both markers: the prime-edit marker, spanning the nick to the edit ± r, and the one ± r around the additional nicking target. A read carrying both intact counts as wild type whatever its length.